HEK293T-HELZ-null

ACC 875

Cell line:

HEK293T-HELZ-null

DSMZ no.:

ACC 875

Species:

human (Homo sapiens)

Cell type:

embryonal kidney

Origin:

this cell line is part of a set of cell lines carrying mutations in different genes affecting mRNA processing and translation efficiency (ACC 872 - ACC 876). Single clone derivative of 293T (DSMZ ACC 635) which was modified by CRISPR/CAS9 editing. In this cell line the ORFs of both alleles of the HELZ gene was disrupted by an insertion in exon 8. The HELZ (Helicase with Zinc-finger) protein is interacting with the CCR-NOT transcription complex promoting decapping of mRNAs and their decay.

Reference(s):

18207, 18216

Biosafety level:

1, GMO-S1

Risk assessment:

genetically modified organism, according to German and European legislation allocated into group S1 (see also parental 293T, DSMZ ACC ACC 635)

Permissions and restrictions:

A, D

Depositor-specific restrictions:

Transfer to third parties needs to be negotiated with the depositor.

DSMZ Cell Culture Data:

Morphology:

fibroblastoid cells growing adherently as monolayer; image; image

Medium:

90% DMEM + 10% h.i. FBS + 2mM L.-glutamine

Subculture:

seed out at about 0.5-1 x 10⁶ cells/80cm²; split confluent culture 1:3 to 1:10 every 2-3 days by tapping the flask (trypsin/EDTA is not necessary)

Incubation:

at 37 °C with 5-10% CO₂

Doubling time:

ca. 24-30 hours

Harvest:

cell harvest of ca. 4-10 x 10⁶ cells/80 cm² flask

Storage:

frozen with 70% medium, 20% FBS, 10% DMSO

DSMZ Scientific Data:

Mycoplasma:

negative in PCR assay

Immunology:

to inquire about expression of EpCAM and intermediate filaments, contact ulfert.rand@dsmz.de.

Authenticity:

STR analysis according to the global standard ANSI/ATCC ASN-0002.1-2021 (2021) resulted in an authentic STR profile of the reference STR database.

Molec. Genetics:

disruption of the HELZ gene was verified by sequence analysis as described in Ref 18207. For internal control the following primers can be used: D-HELZ-F: GGTGTTATGAAGAGGAGAGTAAAGTGA, D-HELZ-R: TGTACTAGCTTAGGACAGAGAGAGAAG. Absence of the HELZ protein was confirmed by Western blot.

Viruses:

PCR: EBV -, HBV -, HCV -, HIV-1 -, HIV-2 -, HTLV-1/2 -, MLV -

Supplied as:

Delivery form		Prices

Frozen culture		450,- €
Growing culture (please inquire for exact delivery time)		900,- €
DNA isolated from cell line (25 µg)		560,- €
DNA isolated from cell line (5 µg)		140,- €

see price list

Print data sheet